RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_263322

mod Site

chr14:100860740-100860741:+

mod Type

m6A

Sequence

ATTCCCACGGGACAGGCTGGACCCAGAGACTCTGGACCCGG

Motif Score

3.62240476190476

RNA Structure Motif

..(((......)))...(((((...))))).

MFE

-7.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE125803, GSE52600, GSE55572, GSE76367, GSE93676, GSE93911

Support sub-Dataset List

GSM3582053, GSM1272366, GSM1272368, GSM1339405, GSM1339429, GSM1982257, GSM2460354, GSM2460358, GSM2754220, GSM2754244, GSM2464901, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921

Cell/Tissue List

A549, H1A, H1B, fibroblasts, MSC, TIME, endometrial

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000519709.6,ENST00000650023.1,ENST00000648123.1,ENST00000650041.1,ENST00000398461.5,ENST00000423456.6,ENST00000412736.7,ENST00000523671.7,ENST00000524131.5,ENST00000649161.1,ENST00000650549.1,ENST00000555928.5,ENST00000521404.5,ENST00000398460.3,ENST00000524035.5,ENST00000648802.1,ENST00000649261.1,ENST00000647780.1,ENST00000521256.1,ENST00000648609.1,ENST00000650513.1,ENST00000522618.1,ENST00000429159.6,ENST00000556736.5,ENST00000398518.6,ENST00000398474.7,ENST00000649036.1,ENST00000648456.1,ENST00000451743.6,ENST00000554639.5,ENST00000637474.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000519709.6	ENSG00000214548.17	MEG3	lincRNA	exon-9
ENST00000650023.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000648123.1	ENSG00000214548.17	MEG3	lincRNA	exon-6
ENST00000650041.1	ENSG00000214548.17	MEG3	lincRNA	exon-9
ENST00000398461.5	ENSG00000214548.17	MEG3	lincRNA	exon-4
ENST00000423456.6	ENSG00000214548.17	MEG3	lincRNA	exon-9
ENST00000412736.7	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000523671.7	ENSG00000214548.17	MEG3	lincRNA	exon-6
ENST00000524131.5	ENSG00000214548.17	MEG3	lincRNA	exon-5
ENST00000649161.1	ENSG00000214548.17	MEG3	lincRNA	exon-6
ENST00000650549.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000555928.5	ENSG00000214548.17	MEG3	lincRNA	exon-5
ENST00000521404.5	ENSG00000214548.17	MEG3	lincRNA	exon-6
ENST00000398460.3	ENSG00000214548.17	MEG3	lincRNA	intron-1
ENST00000524035.5	ENSG00000214548.17	MEG3	lincRNA	exon-4
ENST00000648802.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000649261.1	ENSG00000214548.17	MEG3	lincRNA	exon-10
ENST00000647780.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000521256.1	ENSG00000214548.17	MEG3	lincRNA	exon-2
ENST00000648609.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000650513.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000522618.1	ENSG00000214548.17	MEG3	lincRNA	exon-3
ENST00000429159.6	ENSG00000214548.17	MEG3	lincRNA	exon-7
ENST00000556736.5	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000398518.6	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000398474.7	ENSG00000214548.17	MEG3	lincRNA	exon-6
ENST00000649036.1	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000648456.1	ENSG00000214548.17	MEG3	lincRNA	exon-7
ENST00000451743.6	ENSG00000214548.17	MEG3	lincRNA	exon-7
ENST00000554639.5	ENSG00000214548.17	MEG3	lincRNA	exon-8
ENST00000637474.1	ENSG00000258399.7	AL117190.1	lincRNA	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

31597913, 25456834, 24981863, 27117702, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.