| mod ID | m6A_site_264055 | mod Site | chr14:102086024-102086025:- | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TACCGAACAAACAAGATCGAACTCTCACTATTGTGGATACT |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....................(((....))). |
MFE | -2.30 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 27 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2991416, GSM2884195, GSM3582054, GSM908333, GSM1135032, GSM1135033, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339439, GSM1828594, GSM1828596, GSM1982263, GSM2283212, GSM2324298, GSM2324310, GSM2754213, GSM2754214, GSM2754240, GSM2602070 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, A549, HepG2, hNPCs, hESCs, HEK293T, fibroblasts, CD8T, H1299, Jurkat, peripheral-blood, iSLK, AML |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP,miCLIP | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000334701.11,ENST00000557234.1,ENST00000556554.1,ENST00000216281.12,ENST00000553585.5,ENST00000554401.1 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_149559 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 2 | Writer Name List | METTL14,RBM15B | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1