| mod ID | m6A_site_270845 | mod Site | chr15:40091718-40091719:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGGAAGGACATCGGGCAGGACTGACACTGTGTCTTGTGAA |
|||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||
| RNA Structure Motif |
.(((((((((......)))).....))))). |
MFE | -7.00 | |||||||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 42 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM1135032, GSM1135033, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339429, GSM1594131, GSM2010456, GSM2203047, GSM2203051, GSM2203060, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2417477, GSM2417479, GSM2460358, GSM2754224, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464919, GSM2564019 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, H1A, H1B, hNPCs, hESCs, A549, GM12878, MM6, Huh7, peripheral-blood, HEK293A-TOA, TIME, endometrial, NB4 |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000354670.9,ENST00000561360.5,ENST00000561282.5,ENST00000397573.5 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_349407;panTro5:m6A_site_22253;rheMac8:m6A_site_50306;rn6:m6A_site_66248;susScr11:m6A_site_5201 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1