| mod ID | m6A_site_282361 | mod Site | chr15:63908058-63908059:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GTGAACCTTGGGTGTGAGGGACCAATCCTGTGACCTCCCAG |
||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||
| RNA Structure Motif |
....((((....((((....))))...)))) |
MFE | -7.50 | ||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 40 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739522, GSM2739523, GSM2739535, GSM2991403, GSM3083810, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM1272358, GSM1272360, GSM1272362, GSM1272366, GSM1272368, GSM1594131, GSM1723347, GSM1723351, GSM2203047, GSM2203060, GSM2283211, GSM2283215, GSM2324292, GSM2460352, GSM2754224, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464923 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, H1A, H1B, GM12878, LCLs, Huh7, Jurkat, CD4T, peripheral-blood, MSC, TIME, endometrial |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||
| Transcript ID List | ENST00000457488.5,ENST00000559007.5,ENST00000261891.7 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_634757;panTro5:m6A_site_23211;rheMac8:m6A_site_51105;susScr11:m6A_site_3739 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1