| mod ID | m6A_site_286226 | mod Site | chr15:72218996-72218997:- | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCA |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..((((.((....))))))............ |
MFE | -3.30 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 22 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2987447, GSM908331, GSM1908206, GSM1908208, GSM1908210, GSM1908212, GSM2283214, GSM2324298, GSM2332985, GSM2332986, GSM2332988, GSM2332989, GSM2464905, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, MT4, CD4T, peripheral-blood, HEK293T, endometrial, MM6 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000319622.10,ENST00000335181.10,ENST00000569857.5,ENST00000567118.5,ENST00000564178.5,ENST00000449901.6,ENST00000565154.5,ENST00000564276.1,ENST00000568459.5,ENST00000566809.1,ENST00000389093.7,ENST00000567087.5,ENST00000569050.1,ENST00000562997.5,ENST00000561609.5,ENST00000565184.5,ENST00000568883.5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_632219 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | WTAP | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1