| mod ID | m6A_site_293738 | mod Site | chr15:88907229-88907230:- | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGGCATGGTCAATGCCTGGACACCCAGCAGCAATGACGAT |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
........(((((((....))))..)))... |
MFE | -6.40 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 3 | Support sub-Dataset Num | 9 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | GSE129842, GSE87516, GSE93911 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSE129842, GSM2332985, GSM2332986, GSM2332988, GSM2332989, GSM2332990, GSM2464907, GSM2464917, GSM2464919 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | hESC-HEK293T, endometrial | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | MAZTER-seq,m6A-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000559997.5,ENST00000559770.1,ENST00000558018.5,ENST00000558029.5,ENST00000566497.5,ENST00000268150.13,ENST00000268151.11,ENST00000542878.5,ENST00000558352.5 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_554129;rn6:m6A_site_6019 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID | 31257032, 27773536, 30154548 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1