| mod ID | m6A_site_303946 | mod Site | chr16:2968064-2968065:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCCCGCCGCCGGCGAGATGGACACCTGAGATGCTGTGCTGC |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....(((((....((...)).....))))). |
MFE | -4.10 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 19 | Support sub-Dataset Num | 61 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991400, GSM2991403, GSM2987447, GSM2987448, GSM2987449, GSM3083805, GSM3083806, GSM3083809, GSM3083810, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM928403, GSM1135020, GSM1135021, GSM1135032, GSM1166139, GSM1166140, GSM1166141, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1594131, GSM1982257, GSM2010456, GSM2324292, GSM2324308, GSM2332977, GSM2332985, GSM2332986, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754235, GSM2754237, GSM2754238, GSM2754246, GSM2464921, GSM2564019 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, U2OS, H1A, H1B, GM12878, A549, MM6, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, TIME, endometrial, NB4 |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000572045.5,ENST00000319500.10,ENST00000303746.10,ENST00000575769.1,ENST00000571007.5,ENST00000575885.5 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_253909 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1