| mod ID | m6A_site_304042 | mod Site | chr16:2973425-2973426:- | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GTCCATGTGTTCTGAAAAGGACAGAGGGGGCCTTGGAGTGC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..((((((....))))))((((...)))).. |
MFE | -6.70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 18 | Support sub-Dataset Num | 66 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739523, GSM2739534, GSM2739535, GSM2991400, GSM2991403, GSM2987449, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582054, GSM928399, GSM928401, GSM908337, GSM1135020, GSM1135032, GSM1135033, GSM1272358, GSM1272360, GSM1272362, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1982257, GSM2010454, GSM2010456, GSM2283212, GSM2283213, GSM2324298, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2754211, GSM2754213, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754226, GSM2754235, GSM2754237, GSM2754240, GSM2754244, GSM2754246, GSM2464905, GSM2464909, GSM2464913, GSM2564019, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, A549, H1A, H1B, hNPCs, hESCs, GM12878, MM6, Jurkat, peripheral-blood, HEK293A-TOA, iSLK, MSC, TIME, TREX, endometrial, NB4 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000574385.5,ENST00000262300.13,ENST00000382240.9,ENST00000575981.1,ENST00000440027.6,ENST00000574333.1,ENST00000575040.1,ENST00000574730.5,ENST00000573944.5,ENST00000431515.6,ENST00000574680.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1