| mod ID | m6A_site_305739 | mod Site | chr16:3729372-3729373:- | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTACCTCAGCACCGCCCGGGACCCCCACACAGCAGCCCAGC |
|||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||
| RNA Structure Motif |
............(((...))).......... |
MFE | -2.70 | |||||||||||||
| Support Dataset Num | 21 | Support sub-Dataset Num | 64 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM2987449, GSM3396437, GSM3396438, GSM908331, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166141, GSM1166142, GSM1166143, GSM1166144, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339395, GSM1339401, GSM1339407, GSM1339425, GSM1339439, GSM1594131, GSM1723349, GSM1908206, GSM1982257, GSM2010456, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283215, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2417477, GSM2417478, GSM2417479, GSM2460348, GSM2460350, GSM2754211, GSM2754235, GSM2754238, GSM2464905, GSM2464915, GSM2464923, GSM2464927, GSM2564019, GSM2564022 |
|||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, U2OS, H1B, H1A, hESCs, fibroblasts, A549, GM12878, LCLs, MT4, MM6, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, endometrial, HEC-1-A, NB4 |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000262367.9,ENST00000382070.7 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_227642;rn6:m6A_site_13814;susScr11:m6A_site_80835 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1