| mod ID | m6A_site_307402 | mod Site | chr16:8893936-8893937:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGGCCCCTTAACAGCCTAGAACTTTGGTGCACGTGCCCTCT |
||||||||||||||||||
| Motif Score | 3.37338095238095 | ||||||||||||||||||||
| RNA Structure Motif |
........((((((....)))).))...... |
MFE | -3.00 | ||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 45 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM2884195, GSM2884197, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582054, GSM928399, GSM928401, GSM908329, GSM908333, GSM908337, GSM1135032, GSM1135033, GSM1272358, GSM1272360, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1723347, GSM1723351, GSM1828596, GSM1982263, GSM2460347, GSM2460352, GSM2460356, GSM2460358, GSM2460360, GSM2754226, GSM2464919, GSM2602070, GSM2602071 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, A549, HepG2, H1A, H1B, hNPCs, hESCs, fibroblasts, LCLs, H1299, iSLK, MSC, TIME, TREX, endometrial, AML |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP,miCLIP | ||||||||||||||||||||
| Transcript ID List | ENST00000563961.5,ENST00000344836.9,ENST00000381886.8 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_24861;rheMac8:m6A_site_36095;susScr11:m6A_site_80180 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1