| mod ID | m6A_site_316132 | mod Site | chr16:30064228-30064229:+ | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAACCACACTCCGTCCACGGACTCTCCGTTATTTTAGGAGG |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...........(((((...)))))....... |
MFE | -4.50 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 5 | Support sub-Dataset Num | 16 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM1339425, GSM1339429, GSM1339439, GSM1908206, GSM1908208, GSM1908212, GSM1982257, GSM2417477, GSM2417479, GSM2460348, GSM2460352, GSM2460354, GSM2460360, GSM2754213, GSM2754214, GSM2754226 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
A549, MT4, HEK293A-TOA, iSLK, MSC, TREX |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000562168.5,ENST00000395248.6,ENST00000338110.10,ENST00000568435.6,ENST00000627059.2,ENST00000562302.1,ENST00000566897.6,ENST00000569545.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_570462 | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1