RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_327165

mod Site

chr16:68229708-68229709:-

mod Type

m6A

Sequence

CCTACCCTCAGAGTATCTGGACCTCAGAGACCATGTTGTGC

Motif Score

3.62240476190476

RNA Structure Motif

...((..((.((((.....)))).))..)).

MFE

-4.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE120229, GSE125803, GSE29714, GSE37002, GSE37003, GSE52600, GSE55572, GSE83438, GSE90914, GSE93911

Support sub-Dataset List

GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM908329, GSM908331, GSM908333, GSM908337, GSM1272360, GSM1272368, GSM1339395, GSM2203060, GSM2203064, GSM2417477, GSM2417478, GSM2417479, GSM2464931

Cell/Tissue List

HeLa, HepG2, HEK293T, H1B, hESCs, Huh7, HEK293A-TOA, HEC-1-A

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000473183.6,ENST00000565858.5,ENST00000251366.7,ENST00000566774.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000473183.6	ENSG00000103067.13	ESRP2	protein_coding	utr3-15
ENST00000565858.5	ENSG00000103067.13	ESRP2	protein_coding	utr3-15
ENST00000251366.7	ENSG00000103067.13	ESRP2	retained_intron	exon-13
ENST00000566774.1	ENSG00000103067.13	ESRP2	nonsense_mediated_decay	utr3-9

Conserved Sites

mm10:m6A_site_604905;susScr11:m6A_site_105052

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31597913, 22608085, 22575960, 25456834, 24981863, 27773535, 28525753, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.