RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_334972

mod Site

chr16:85805119-85805120:+

mod Type

m6A

Sequence

CGAGTGTGGGTATTGAAGGGACCCACAGGCGCGCCCAGCAG

Motif Score

3.62240476190476

RNA Structure Motif

((((((.........))))))..........

MFE

-8.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE37002, GSE93911

Support sub-Dataset List

GSM908331, GSM2464919

Cell/Tissue List

HepG2, endometrial

Seq Type List

m6A-seq

Transcript ID List

ENST00000566405.5,ENST00000563774.1,ENST00000562336.5,ENST00000564903.1,ENST00000567266.5,ENST00000561569.5,ENST00000567241.5,ENST00000570123.5,ENST00000568794.5,ENST00000564648.1,ENST00000562929.1,ENST00000566617.1,ENST00000564544.1,ENST00000253452.6,ENST00000568339.5,ENST00000569997.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000566405.5	ENSG00000131143.8	COX4I1	protein_coding	intron-3
ENST00000563774.1	ENSG00000131143.8	COX4I1	retained_intron	exon-3
ENST00000562336.5	ENSG00000131143.8	COX4I1	protein_coding	intron-3
ENST00000564903.1	ENSG00000131143.8	COX4I1	protein_coding	intron-2
ENST00000567266.5	ENSG00000131143.8	COX4I1	retained_intron	exon-2
ENST00000561569.5	ENSG00000131143.8	COX4I1	protein_coding	intron-3
ENST00000567241.5	ENSG00000131143.8	COX4I1	retained_intron	exon-3
ENST00000570123.5	ENSG00000131143.8	COX4I1	processed_transcript	exon-3
ENST00000568794.5	ENSG00000131143.8	COX4I1	protein_coding	intron-3
ENST00000564648.1	ENSG00000131143.8	COX4I1	retained_intron	exon-2
ENST00000562929.1	ENSG00000131143.8	COX4I1	processed_transcript	intron-1
ENST00000566617.1	ENSG00000131143.8	COX4I1	retained_intron	exon-3
ENST00000564544.1	ENSG00000131143.8	COX4I1	nonsense_mediated_decay	utr3-3
ENST00000253452.6	ENSG00000131143.8	COX4I1	protein_coding	intron-3
ENST00000568339.5	ENSG00000131143.8	COX4I1	retained_intron	exon-3
ENST00000569997.1	ENSG00000131143.8	COX4I1	retained_intron	exon-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH31039	chr16:85805102-85805147	SBDH828-8140

PubMed ID

22575960, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.