RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_346526

mod Site

chr17:7676016-7676017:-

mod Type

m6A

Sequence

TGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGC

Motif Score

3.64304761904762

RNA Structure Motif

...(((((..((((.....)).))..)))))

MFE

-4.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493

Support sub-Dataset List

GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2991403

Cell/Tissue List

HeLa

Seq Type List

m6A-seq

Transcript ID List

ENST00000514944.5,ENST00000620739.4,ENST00000269305.8,ENST00000622645.4,ENST00000503591.1,ENST00000508793.5,ENST00000635293.1,ENST00000615910.4,ENST00000359597.8,ENST00000610292.4,ENST00000509690.5,ENST00000445888.6,ENST00000505014.5,ENST00000619485.4,ENST00000420246.6,ENST00000610538.4,ENST00000413465.6,ENST00000604348.5,ENST00000617185.4,ENST00000455263.6

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000514944.5	ENSG00000141510.17	TP53	protein_coding	intron-3
ENST00000620739.4	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000269305.8	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000622645.4	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000503591.1	ENSG00000141510.17	TP53	protein_coding	cds-5
ENST00000508793.5	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000635293.1	ENSG00000141510.17	TP53	nonsense_mediated_decay	cds-4
ENST00000615910.4	ENSG00000141510.17	TP53	protein_coding	intron-4
ENST00000359597.8	ENSG00000141510.17	TP53	protein_coding	cds-3
ENST00000610292.4	ENSG00000141510.17	TP53	protein_coding	cds-3
ENST00000509690.5	ENSG00000141510.17	TP53	protein_coding	intron-1
ENST00000445888.6	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000505014.5	ENSG00000141510.17	TP53	retained_intron	exon-3
ENST00000619485.4	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000420246.6	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000610538.4	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000413465.6	ENSG00000141510.17	TP53	protein_coding	cds-3
ENST00000604348.5	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000617185.4	ENSG00000141510.17	TP53	protein_coding	cds-4
ENST00000455263.6	ENSG00000141510.17	TP53	protein_coding	cds-4

Conserved Sites

mm10:m6A_site_95537

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.