| mod ID | m6A_site_361657 | mod Site | chr17:40342681-40342682:+ | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CGCAGGACTTCCCAGCTCGGACCTCTTGCCTTCGAGGGGAA |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..........((((((.........)))))) |
MFE | -3.70 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 27 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2884195, GSM2884199, GSM2987448, GSM2987449, GSM3582053, GSM1272364, GSM2332975, GSM2332977, GSM2332978, GSM2332988, GSM2417479, GSM2460356, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754235, GSM2754237, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464923, GSM2464931 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
CD34, HepG2, A549, H1B, GSC-11, HEK293T, HEK293A-TOA, TIME, iSLK, MSC, endometrial, HEC-1-A |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000394081.7,ENST00000394089.6,ENST00000254066.10,ENST00000577646.5,ENST00000425707.7,ENST00000579727.5,ENST00000394086.7 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1