RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_363386

mod Site

chr17:42201365-42201366:-

mod Type

m6A

Sequence

TGTGTCTTAAGAGTGGCTGGACTTTGACATGTGGCTGTTTG

Motif Score

4.06504166666667

RNA Structure Motif

......(((.((((........)).)).)))

MFE

-5.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE125803, GSE29714, GSE46705, GSE55572, GSE70299, GSE71154, GSE83438

Support sub-Dataset List

GSM2991403, GSM2991416, GSM3396437, GSM3396438, GSM3582048, GSM3582052, GSM3582054, GSM928401, GSM1135032, GSM1339395, GSM1339401, GSM1339407, GSM1339425, GSM1339427, GSM1339439, GSM1723347, GSM1723349, GSM1828594, GSM1828596, GSM2203052

Cell/Tissue List

HeLa, HEK293T, A549, hESCs, fibroblasts, LCLs, CD8T, Huh7

Seq Type List

m6A-seq,MeRIP-seq,m6A-CLIP/IP

Transcript ID List

ENST00000293328.7

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000293328.7	ENSG00000173757.9	STAT5B	protein_coding	utr3-19

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31597913, 22608085, 24284625, 24981863, 27773535, 26404942

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.