Details of RNA Modification Site of hg38
mod ID m6A_site_36417 mod Site chr1:77063150-77063151:+
mod Type m6A Sequence TATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTG
Motif Score 3.31938095238095
RNA Structure Motif ................((((...))))....
 MFE -3.20
Support Dataset Num 5 Support sub-Dataset Num 21
Support Dataset List
Support sub-Dataset List

GSM928399, GSM1166139, GSM1166140, GSM1166141, GSM1166142, GSM1166143, GSM1166144, GSM1339393, GSM1339395, GSM1339407, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460360, GSM2754211, GSM2754213, GSM2754226, GSM2754235, GSM2754237, GSM2464931
Cell/Tissue List

HEK293T, U2OS, hNPCs, hESCs, fibroblasts, iSLK, TREX, HEC-1-A
Seq Type List MeRIP-seq,m6A-seq
Transcript ID List ENST00000477717.6,ENST00000318803.6
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000477717.6ENSG00000117069.15ST6GALNAC5protein_codingcds-5
ENST00000318803.6ENSG00000117069.15ST6GALNAC5nonsense_mediated_decayutr3-5
Conserved Sites mm10:m6A_site_407493
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1