RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_364898

mod Site

chr17:43093091-43093092:-

mod Type

m6A

Sequence

GCATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAA

Motif Score

4.06504166666667

RNA Structure Motif

......(((...)))((((.....))))...

MFE

-2.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE29714, GSE55572, GSE71154

Support sub-Dataset List

GSM2991403, GSM2991416, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM1339393, GSM1339427, GSM1828596

Cell/Tissue List

HeLa, HEK293T, hNPCs, A549

Seq Type List

m6A-seq,MeRIP-seq,m6A-CLIP/IP

Transcript ID List

ENST00000491747.6,ENST00000468300.5,ENST00000493795.5,ENST00000461221.5,ENST00000478531.5,ENST00000484087.5,ENST00000471181.7,ENST00000493919.5,ENST00000586385.5,ENST00000354071.7,ENST00000591849.5,ENST00000634433.1,ENST00000352993.7,ENST00000487825.5,ENST00000357654.8,ENST00000591534.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000491747.6	ENSG00000012048.22	BRCA1	protein_coding	intron-10
ENST00000468300.5	ENSG00000012048.22	BRCA1	protein_coding	intron-10
ENST00000493795.5	ENSG00000012048.22	BRCA1	protein_coding	cds-9
ENST00000461221.5	ENSG00000012048.22	BRCA1	nonsense_mediated_decay	utr3-10
ENST00000478531.5	ENSG00000012048.22	BRCA1	protein_coding	intron-10
ENST00000484087.5	ENSG00000012048.22	BRCA1	protein_coding	intron-4
ENST00000471181.7	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000493919.5	ENSG00000012048.22	BRCA1	protein_coding	intron-9
ENST00000586385.5	ENSG00000012048.22	BRCA1	protein_coding	intron-1
ENST00000354071.7	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000591849.5	ENSG00000012048.22	BRCA1	protein_coding	intron-1
ENST00000634433.1	ENSG00000012048.22	BRCA1	protein_coding	cds-8
ENST00000352993.7	ENSG00000012048.22	BRCA1	protein_coding	intron-9
ENST00000487825.5	ENSG00000012048.22	BRCA1	protein_coding	intron-4
ENST00000357654.8	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000591534.5	ENSG00000012048.22	BRCA1	protein_coding	intron-1

Conserved Sites

mm10:m6A_site_114812;panTro5:m6A_site_28513;rn6:m6A_site_19816

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 22608085, 24981863, 26404942

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.