RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_364919

mod Site

chr17:43093745-43093746:-

mod Type

m6A

Sequence

AGCAGTATAAGCAATATGGAACTCGAATTAAATATCCACAA

Motif Score

3.37338095238095

RNA Structure Motif

...............................

MFE

0.00

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE125780, GSE29714, GSE55572, GSE83438

Support sub-Dataset List

GSM2991416, GSM3396437, GSM3396438, GSM4024128, GSM928399, GSM928401, GSM1339401, GSM1339425, GSM2203060, GSM2203063, GSM2203064

Cell/Tissue List

HeLa, HEK293T, A549, Huh7

Seq Type List

m6A-seq,MeRIP-seq,DART-seq

Transcript ID List

ENST00000461221.5,ENST00000591534.5,ENST00000468300.5,ENST00000357654.8,ENST00000591849.5,ENST00000484087.5,ENST00000493919.5,ENST00000586385.5,ENST00000354071.7,ENST00000478531.5,ENST00000491747.6,ENST00000652672.1,ENST00000412061.3,ENST00000471181.7,ENST00000477152.5,ENST00000634433.1,ENST00000352993.7,ENST00000470026.5,ENST00000487825.5,ENST00000493795.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000461221.5	ENSG00000012048.22	BRCA1	nonsense_mediated_decay	utr3-10
ENST00000591534.5	ENSG00000012048.22	BRCA1	protein_coding	intron-1
ENST00000468300.5	ENSG00000012048.22	BRCA1	protein_coding	intron-10
ENST00000357654.8	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000591849.5	ENSG00000012048.22	BRCA1	protein_coding	intron-1
ENST00000484087.5	ENSG00000012048.22	BRCA1	protein_coding	intron-4
ENST00000493919.5	ENSG00000012048.22	BRCA1	protein_coding	intron-9
ENST00000586385.5	ENSG00000012048.22	BRCA1	protein_coding	intron-1
ENST00000354071.7	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000478531.5	ENSG00000012048.22	BRCA1	protein_coding	intron-10
ENST00000491747.6	ENSG00000012048.22	BRCA1	protein_coding	intron-10
ENST00000652672.1	ENSG00000012048.22	BRCA1	protein_coding	cds-11
ENST00000412061.3	ENSG00000012048.22	BRCA1	non_stop_decay	cds-2
ENST00000471181.7	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000477152.5	ENSG00000012048.22	BRCA1	protein_coding	cds-9
ENST00000634433.1	ENSG00000012048.22	BRCA1	protein_coding	cds-8
ENST00000352993.7	ENSG00000012048.22	BRCA1	protein_coding	intron-9
ENST00000470026.5	ENSG00000012048.22	BRCA1	protein_coding	cds-10
ENST00000487825.5	ENSG00000012048.22	BRCA1	protein_coding	intron-4
ENST00000493795.5	ENSG00000012048.22	BRCA1	protein_coding	cds-9

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31548708, 22608085, 24981863, 27773535

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.