| mod ID | m6A_site_369381 | mod Site | chr17:48576649-48576650:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCAGGGGATGGGGTGGGGGGACAGGAGGGGGCCCTGGGGCC |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..........((((..(......)..)))). |
MFE | -5.90 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 18 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM928399, GSM1723351, GSM1982263, GSM2283211, GSM2283212, GSM2283213, GSM2332975, GSM2332977, GSM2332978, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2464921 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
CD34, HEK293T, LCLs, H1299, Jurkat, GSC-11, HEK293A-TOA, MSC, endometrial |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000489475.5,ENST00000465120.3,ENST00000552000.2,ENST00000498678.5,ENST00000476342.1,ENST00000472863.5,ENST00000332503.6,ENST00000460160.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1