| mod ID | m6A_site_379066 | mod Site | chr17:67826063-67826064:+ | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCGGCGGCCACCTGGCCCGGACCACCGCGGCCCGGAGGGCC |
||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
.....((.(((((((....))).)))).)). |
MFE | -14.60 | ||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 40 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739522, GSM2739523, GSM2739535, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM2987448, GSM3582046, GSM3582047, GSM1166139, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339401, GSM1339425, GSM1339427, GSM1339439, GSM1908206, GSM1908208, GSM2010454, GSM2010456, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2332975, GSM2332977, GSM2332978, GSM2332987, GSM2332988, GSM2332989, GSM2332990 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, U2OS, H1A, H1B, hNPCs, HEK293T, A549, MT4, MM6, Jurkat, GSC-11 |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000306378.11,ENST00000321892.8,ENST00000342579.8,ENST00000544778.6,ENST00000644067.1 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_118861 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | ||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1