| mod ID | m6A_site_379146 | mod Site | chr17:67909755-67909756:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AAAGATTACTGAGAAGAAGGACCAAGGTAAGGAGAGTCAGC |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((((..(.........)..)))))...... |
MFE | -1.30 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 26 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2991416, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM3900734, GSM928399, GSM928401, GSM1135032, GSM1339393, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1723347, GSM2203044, GSM2203052, GSM2203056, GSM2203060, GSM2203063, GSM2203064 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, BGC823, hNPCs, fibroblasts, A549, LCLs, Huh7 |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000342579.8,ENST00000544778.6,ENST00000321892.8,ENST00000644067.1,ENST00000424123.7,ENST00000306378.11 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | rheMac8:m6A_site_25462 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1