| mod ID | m6A_site_381830 | mod Site | chr17:75320220-75320221:- | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
ACCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGG |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((((((((((....)))....)))))))). |
MFE | -6.40 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 32 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM2991416, GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM1828596, GSM1982257, GSM1982263, GSM2203051, GSM2203060, GSM2460345, GSM2460347, GSM2460350, GSM2460354, GSM2754226 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, hNPCs, hESCs, fibroblasts, A549, LCLs, CD8T, H1299, Huh7, iSLK, MSC, TREX |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000392564.5,ENST00000648046.1,ENST00000392563.5,ENST00000316615.9,ENST00000316804.10,ENST00000581959.1,ENST00000392562.5 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_30792;rheMac8:m6A_site_25693;susScr11:m6A_site_20623 | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1