RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_385848

mod Site

chr17:78855802-78855803:-

mod Type

m6A

Sequence

GGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACA

Motif Score

4.06504166666667

RNA Structure Motif

.....((((((((.......))).)))))..

MFE

-8.60

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE112795, GSE37002, GSE46705, GSE55572, GSE76414, GSE87190, GSE93911, GSE97408

Support sub-Dataset List

GSM2739503, GSM2739522, GSM2739534, GSM2987447, GSM2987448, GSM3083806, GSM3083809, GSM908331, GSM1135020, GSM1339429, GSM2010454, GSM2010456, GSM2324298, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464927, GSM2464931, GSM2564022

Cell/Tissue List

HeLa, HepG2, A549, MM6, peripheral-blood, endometrial, HEC-1-A

Seq Type List

m6A-seq

Transcript ID List

ENST00000592761.2,ENST00000536189.6,ENST00000585421.5,ENST00000262768.11,ENST00000586057.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000592761.2	ENSG00000035862.12	TIMP2	nonsense_mediated_decay	utr3-4
ENST00000536189.6	ENSG00000035862.12	TIMP2	protein_coding	cds-5
ENST00000585421.5	ENSG00000035862.12	TIMP2	protein_coding	cds-5
ENST00000262768.11	ENSG00000035862.12	TIMP2	protein_coding	cds-5
ENST00000586057.5	ENSG00000035862.12	TIMP2	protein_coding	cds-4

Conserved Sites

mm10:m6A_site_123706

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31061416, 22575960, 24284625, 24981863, 28017614, 29249359, 30154548, 29290617

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.