RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_389176

mod Site

chr17:81859138-81859139:-

mod Type

m6A

Sequence

TGAACTGTCTTTAGAGAGGGACTGGCCTGCCGACTTGGAAG

Motif Score

4.06504166666667

RNA Structure Motif

.((((((....))))))(((....)))....

MFE

-4.60

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE76414, GSE87190, GSE90914, GSE93911

Support sub-Dataset List

GSM2739502, GSM2739506, GSM2739507, GSM2739523, GSM2991403, GSM3396437, GSM3396438, GSM2010454, GSM2010456, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2417477, GSM2417478, GSM2417479, GSM2464931

Cell/Tissue List

HeLa, HEK293T, MM6, peripheral-blood, HEK293A-TOA, HEC-1-A

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000467086.5,ENST00000472244.5,ENST00000576052.1,ENST00000570907.5,ENST00000576541.1,ENST00000571617.1,ENST00000576380.5,ENST00000331483.9,ENST00000574007.5,ENST00000471535.1,ENST00000576390.5,ENST00000573778.6,ENST00000574914.1,ENST00000439918.6,ENST00000575069.5,ENST00000466567.2

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000467086.5	ENSG00000185624.15	P4HB	processed_transcript	intron-2
ENST00000472244.5	ENSG00000185624.15	P4HB	processed_transcript	exon-1
ENST00000576052.1	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000570907.5	ENSG00000185624.15	P4HB	protein_coding	intron-1
ENST00000576541.1	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000571617.1	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000576380.5	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000331483.9	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000574007.5	ENSG00000185624.15	P4HB	retained_intron	intron-1
ENST00000471535.1	ENSG00000185624.15	P4HB	processed_transcript	intron-2
ENST00000576390.5	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000573778.6	ENSG00000185624.15	P4HB	protein_coding	intron-1
ENST00000574914.1	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000439918.6	ENSG00000185624.15	P4HB	protein_coding	intron-2
ENST00000575069.5	ENSG00000185624.15	P4HB	nonsense_mediated_decay	intron-2
ENST00000466567.2	ENSG00000185624.15	P4HB	retained_intron	exon-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 28017614, 29249359, 28525753, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.