| mod ID | m6A_site_389177 | mod Site | chr17:81859155-81859156:- | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGCTGTGGCACTGCCCTTGAACTGTCTTTAGAGAGGGACTG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.(((...)))......((.((....)).)). |
MFE | -4.30 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 8 | Support sub-Dataset Num | 24 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2991403, GSM2987447, GSM2987448, GSM1135020, GSM2010454, GSM2010456, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332990, GSM2417479, GSM2464905, GSM2464909, GSM2464911, GSM2464913, GSM2464917, GSM2464919, GSM2464923, GSM2464931 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, MM6, peripheral-blood, HEK293T, HEK293A-TOA, endometrial, HEC-1-A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000439918.6,ENST00000571617.1,ENST00000472244.5,ENST00000576052.1,ENST00000466567.2,ENST00000576541.1,ENST00000574914.1,ENST00000471535.1,ENST00000575069.5,ENST00000570907.5,ENST00000573778.6,ENST00000574007.5,ENST00000331483.9,ENST00000576390.5,ENST00000576380.5,ENST00000467086.5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1