| mod ID | m6A_site_389532 | mod Site | chr17:81934436-81934437:- | |||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCACCCAGGCCAGCTCAAGGACAACGTCAGCTCTCCTGGTG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..((..((((...(.....)...))))..)) |
MFE | -4.30 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 8 | Support sub-Dataset Num | 18 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2991399, GSM2991400, GSM2987447, GSM2987448, GSM3083806, GSE129842, GSM1135020, GSM1135021, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2464905, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, hESC-HEK293T, endometrial, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MAZTER-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000584848.5,ENST00000402252.6,ENST00000403172.8,ENST00000405481.8,ENST00000337943.9,ENST00000577756.5,ENST00000619204.4,ENST00000582198.5,ENST00000629768.2,ENST00000329875.12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | susScr11:m6A_site_18982 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1