Details of RNA Modification Site of hg38
mod ID m6A_site_400769 mod Site chr18:48040138-48040139:-
mod Type m6A Sequence CTGCCGGGGGGGCCTCTGGGACCCATCAAGGCGGAGAACGA
Motif Score 3.62240476190476
RNA Structure Motif (((((..((...))..))).)).........
 MFE -6.90
Support Dataset Num 8 Support sub-Dataset Num 17
Support Dataset List
Support sub-Dataset List

GSM3396437, GSM3396438, GSM928403, GSM908337, GSM1272364, GSM1272366, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332989, GSM2417477, GSM2417478, GSM2464905, GSM2464909, GSM2464911, GSM2464923
Cell/Tissue List

HEK293T, HepG2, H1B, H1A, GSC-11, HEK293A-TOA, endometrial
Seq Type List MeRIP-seq,m6A-seq
Transcript ID List ENST00000590800.6,ENST00000588982.5,ENST00000586438.5,ENST00000535628.6
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000590800.6ENSG00000184828.10ZBTB7Cprotein_codingcds-4
ENST00000588982.5ENSG00000184828.10ZBTB7Cprotein_codingcds-3
ENST00000586438.5ENSG00000184828.10ZBTB7Cprotein_codingcds-2
ENST00000535628.6ENSG00000184828.10ZBTB7Cprotein_codingcds-2
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1