RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_401928

mod Site

chr18:55322067-55322068:-

mod Type

m6A

Sequence

AGAAAAAGAAAAAAGTGAAGACTGCAGAAATTTGTAAGAAT

Motif Score

3.31938095238095

RNA Structure Motif

........(((....)))((((....)))).

MFE

-1.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE83438

Support sub-Dataset List

GSM2203063, GSM2203064

Cell/Tissue List

Huh7

Seq Type List

MeRIP-seq

Transcript ID List

ENST00000627685.2,ENST00000643689.1,ENST00000616053.4,ENST00000629387.2,ENST00000540999.5,ENST00000457482.7,ENST00000626584.2,ENST00000630319.2,ENST00000635990.2,ENST00000564403.6,ENST00000563686.5,ENST00000630828.2,ENST00000636400.2,ENST00000629343.2,ENST00000564999.5,ENST00000566286.5,ENST00000627136.2,ENST00000637115.2,ENST00000537856.7,ENST00000635822.2,ENST00000565018.6,ENST00000564228.5,ENST00000567880.5,ENST00000356073.8,ENST00000630268.2,ENST00000630720.3,ENST00000636822.2,ENST00000562638.5,ENST00000566279.5,ENST00000638154.2,ENST00000631043.2,ENST00000570177.6,ENST00000630712.2,ENST00000568740.5,ENST00000543082.5,ENST00000628636.2,ENST00000636751.2,ENST00000626595.2,ENST00000565908.6,ENST00000566514.5,ENST00000565580.3,ENST00000562680.5,ENST00000398339.5,ENST00000562030.3,ENST00000544241.6,ENST00000568673.5,ENST00000625925.2,ENST00000561992.5,ENST00000569012.5,ENST00000637250.2,ENST00000568186.5,ENST00000568169.5,ENST00000537578.5,ENST00000562607.5,ENST00000354452.7,ENST00000637239.2,ENST00000628078.2,ENST00000566777.5,ENST00000626425.2

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000627685.2	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000643689.1	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000616053.4	ENSG00000196628.16	TCF4	protein_coding	intron-6
ENST00000629387.2	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000540999.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000457482.7	ENSG00000196628.16	TCF4	protein_coding	utr5-1
ENST00000626584.2	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000630319.2	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000635990.2	ENSG00000196628.16	TCF4	processed_transcript	intron-3
ENST00000564403.6	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000563686.5	ENSG00000196628.16	TCF4	retained_intron	intron-5
ENST00000630828.2	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000636400.2	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000629343.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000564999.5	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000566286.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000627136.2	ENSG00000196628.16	TCF4	processed_transcript	intron-7
ENST00000637115.2	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-9
ENST00000537856.7	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000635822.2	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000565018.6	ENSG00000196628.16	TCF4	protein_coding	intron-5
ENST00000564228.5	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000567880.5	ENSG00000196628.16	TCF4	protein_coding	intron-5
ENST00000356073.8	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000630268.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000630720.3	ENSG00000196628.16	TCF4	protein_coding	utr5-1
ENST00000636822.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000562638.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000566279.5	ENSG00000196628.16	TCF4	protein_coding	intron-6
ENST00000638154.2	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000631043.2	ENSG00000196628.16	TCF4	processed_transcript	intron-4
ENST00000570177.6	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000630712.2	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000568740.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000543082.5	ENSG00000196628.16	TCF4	protein_coding	intron-6
ENST00000628636.2	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000636751.2	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-8
ENST00000626595.2	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000565908.6	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000566514.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000565580.3	ENSG00000196628.16	TCF4	processed_transcript	intron-4
ENST00000562680.5	ENSG00000196628.16	TCF4	retained_intron	intron-3
ENST00000398339.5	ENSG00000196628.16	TCF4	protein_coding	intron-9
ENST00000562030.3	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000544241.6	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000568673.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000625925.2	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000561992.5	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000569012.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000637250.2	ENSG00000196628.16	TCF4	processed_transcript	intron-3
ENST00000568186.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000568169.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000537578.5	ENSG00000196628.16	TCF4	protein_coding	intron-7
ENST00000562607.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000354452.7	ENSG00000196628.16	TCF4	protein_coding	intron-8
ENST00000637239.2	ENSG00000196628.16	TCF4	processed_transcript	intron-6
ENST00000628078.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000566777.5	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000626425.2	ENSG00000196628.16	TCF4	protein_coding	intron-7

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

27773535

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.