RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_401950

mod Site

chr18:55551709-55551710:-

mod Type

m6A

Sequence

ATATTTGAAATAAATTGAGGACCGTAACTTGGCAAGTATGA

Motif Score

3.62240476190476

RNA Structure Motif

................(((.....)))....

MFE

-1.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE107954

Support sub-Dataset List

GSM2884195, GSM2884197, GSM2884199

Cell/Tissue List

CD34

Seq Type List

m6A-seq

Transcript ID List

ENST00000540999.5,ENST00000565908.6,ENST00000567880.5,ENST00000627136.2,ENST00000635822.2,ENST00000398339.5,ENST00000563824.5,ENST00000354452.7,ENST00000630224.2,ENST00000564403.6,ENST00000564343.5,ENST00000637941.1,ENST00000565018.6,ENST00000566279.5,ENST00000616053.4,ENST00000568147.5,ENST00000636400.2,ENST00000638154.2,ENST00000356073.8,ENST00000537578.5,ENST00000565124.4,ENST00000564999.5,ENST00000566286.5,ENST00000627568.2,ENST00000566514.5,ENST00000562543.5,ENST00000630319.2,ENST00000626595.2,ENST00000562847.5,ENST00000627784.2,ENST00000637239.2,ENST00000568740.5,ENST00000626425.2,ENST00000627320.2,ENST00000568169.5,ENST00000636751.2,ENST00000569357.4,ENST00000627685.2,ENST00000629387.2,ENST00000568673.5,ENST00000637115.2,ENST00000563888.6

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000540999.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000565908.6	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000567880.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000627136.2	ENSG00000196628.16	TCF4	processed_transcript	intron-2
ENST00000635822.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000398339.5	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000563824.5	ENSG00000196628.16	TCF4	protein_coding	intron-1
ENST00000354452.7	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000630224.2	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-3
ENST00000564403.6	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000564343.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000637941.1	ENSG00000196628.16	TCF4	processed_transcript	exon-4
ENST00000565018.6	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000566279.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000616053.4	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000568147.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000636400.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000638154.2	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000356073.8	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000537578.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000565124.4	ENSG00000196628.16	TCF4	protein_coding	intron-4
ENST00000564999.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000566286.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000627568.2	ENSG00000196628.16	TCF4	processed_transcript	intron-3
ENST00000566514.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000562543.5	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000630319.2	ENSG00000196628.16	TCF4	protein_coding	intron-1
ENST00000626595.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000562847.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000627784.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000637239.2	ENSG00000196628.16	TCF4	processed_transcript	intron-1
ENST00000568740.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000626425.2	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000627320.2	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-4
ENST00000568169.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000636751.2	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-2
ENST00000569357.4	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-3
ENST00000627685.2	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000629387.2	ENSG00000196628.16	TCF4	protein_coding	intron-3
ENST00000568673.5	ENSG00000196628.16	TCF4	protein_coding	intron-2
ENST00000637115.2	ENSG00000196628.16	TCF4	nonsense_mediated_decay	intron-3
ENST00000563888.6	ENSG00000196628.16	TCF4	protein_coding	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

30065315

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.