| mod ID | m6A_site_405339 | mod Site | chr18:79527632-79527633:+ | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCTGACTTCAGCAGACAAAGACTTTTGAATAAATAAACTGA |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.(((((.((.......)).)))))....... |
MFE | -1.60 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 36 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2991403, GSM3396437, GSM3396438, GSM3582048, GSM3582052, GSM1166139, GSM1272360, GSM1272368, GSM1339393, GSM1339395, GSM1339429, GSM1594131, GSM1828594, GSM2010454, GSM2283214, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754211, GSM2754220, GSM2754224, GSM2754235, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754248 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, U2OS, H1B, hNPCs, hESCs, GM12878, CD8T, MM6, CD4T, HEK293A-TOA, iSLK, MSC, TIME |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000253506.9,ENST00000318065.9,ENST00000397790.6,ENST00000590172.1,ENST00000545796.5,ENST00000590313.5,ENST00000586695.1,ENST00000590861.1,ENST00000329101.8 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1