| mod ID | m6A_site_411501 | mod Site | chr19:3979985-3979986:- | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGTGGGCCTCGTGGGCGTGGACCAGTTCCTGGTGAAGACGG |
||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||
| RNA Structure Motif |
((((...))))....(((((...)))))... |
MFE | -9.60 | ||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 16 | ||||||||||
| Support Dataset List | |||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2884195, GSM2884197, GSM2987447, GSM2987448, GSM908331, GSM1135020, GSM1135021, GSM1982257, GSM2010454, GSM2324298, GSM2324310, GSM2564019, GSM2564022, GSM2602070 |
||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, A549, MM6, peripheral-blood, NB4, AML |
||||||||||||
| Seq Type List | m6A-seq,miCLIP | ||||||||||||
| Transcript ID List | ENST00000309311.7 | ||||||||||||
| Transcript Detail |
|
||||||||||||
| Conserved Sites | mm10:m6A_site_63036 | ||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||
| snoRNA Guide Detail | na | ||||||||||||
| writer Num | 1 | Writer Name List | RBM15B | ||||||||||
| Writer Catalysis Detail |
|
||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1