RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_411825

mod Site

chr19:4177135-4177136:-

mod Type

m6A

Sequence

TTCCTGCTCTTCCCACAGGGACAAACTGGCAGAGCTCCACG

Motif Score

3.64304761904762

RNA Structure Motif

(((((((((...)))).........))))).

MFE

-9.00

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE110320, GSE112795, GSE76414, GSE87190, GSE87516, GSE93911

Support sub-Dataset List

GSM2987447, GSM2987448, GSM3083805, GSM3083806, GSM3083809, GSM3083810, GSM2010456, GSM2324298, GSM2324308, GSM2324310, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2464921, GSM2464923, GSM2464931

Cell/Tissue List

HepG2, HeLa, MM6, peripheral-blood, HEK293T, endometrial, HEC-1-A

Seq Type List

m6A-seq

Transcript ID List

ENST00000595670.5,ENST00000596119.5,ENST00000600938.5,ENST00000305232.10,ENST00000601069.5,ENST00000600540.5,ENST00000597896.5,ENST00000601571.1,ENST00000601488.5,ENST00000599394.1,ENST00000599365.5,ENST00000596298.5,ENST00000337491.7,ENST00000594279.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000595670.5	ENSG00000077463.15	SIRT6	retained_intron	exon-4
ENST00000596119.5	ENSG00000077463.15	SIRT6	retained_intron	exon-3
ENST00000600938.5	ENSG00000077463.15	SIRT6	nonsense_mediated_decay	utr3-3
ENST00000305232.10	ENSG00000077463.15	SIRT6	protein_coding	cds-4
ENST00000601069.5	ENSG00000077463.15	SIRT6	retained_intron	exon-3
ENST00000600540.5	ENSG00000077463.15	SIRT6	retained_intron	exon-3
ENST00000597896.5	ENSG00000077463.15	SIRT6	protein_coding	cds-3
ENST00000601571.1	ENSG00000077463.15	SIRT6	protein_coding	cds-3
ENST00000601488.5	ENSG00000077463.15	SIRT6	protein_coding	cds-3
ENST00000599394.1	ENSG00000077463.15	SIRT6	retained_intron	exon-2
ENST00000599365.5	ENSG00000077463.15	SIRT6	nonsense_mediated_decay	utr3-3
ENST00000596298.5	ENSG00000077463.15	SIRT6	retained_intron	exon-4
ENST00000337491.7	ENSG00000077463.15	SIRT6	protein_coding	cds-4
ENST00000594279.5	ENSG00000077463.15	SIRT6	protein_coding	cds-4

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

3086759, 31061416, 28017614, 29249359, 27773536, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.