RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_411829

mod Site

chr19:4182498-4182499:-

mod Type

m6A

Sequence

GGGGCTGTCGCCGTACGCGGACAAGGGCAAGTGCGGCCTCC

Motif Score

3.64304761904762

RNA Structure Motif

.....((((((((........))..))))))

MFE

-9.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE129842, GSE46705, GSE90914, GSE93676

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSE129842, GSM1135021, GSM2417477, GSM2417478, GSM2417479, GSM2460356, GSM2460358, GSM2460360, GSM2754224, GSM2754248

Cell/Tissue List

HeLa, hESC-HEK293T, HEK293A-TOA, TIME, TREX

Seq Type List

m6A-seq,MAZTER-seq,MeRIP-seq

Transcript ID List

ENST00000596119.5,ENST00000595670.5,ENST00000600540.5,ENST00000601069.5,ENST00000337491.7,ENST00000599365.5,ENST00000597896.5,ENST00000601571.1,ENST00000594341.1,ENST00000600938.5,ENST00000596298.5,ENST00000305232.10,ENST00000601488.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000596119.5	ENSG00000077463.15	SIRT6	retained_intron	exon-1
ENST00000595670.5	ENSG00000077463.15	SIRT6	retained_intron	exon-1
ENST00000600540.5	ENSG00000077463.15	SIRT6	retained_intron	exon-1
ENST00000601069.5	ENSG00000077463.15	SIRT6	retained_intron	exon-1
ENST00000337491.7	ENSG00000077463.15	SIRT6	protein_coding	cds-1
ENST00000599365.5	ENSG00000077463.15	SIRT6	nonsense_mediated_decay	cds-1
ENST00000597896.5	ENSG00000077463.15	SIRT6	protein_coding	cds-1
ENST00000601571.1	ENSG00000077463.15	SIRT6	protein_coding	cds-1
ENST00000594341.1	ENSG00000077463.15	SIRT6	retained_intron	exon-1
ENST00000600938.5	ENSG00000077463.15	SIRT6	nonsense_mediated_decay	cds-1
ENST00000596298.5	ENSG00000077463.15	SIRT6	retained_intron	exon-1
ENST00000305232.10	ENSG00000077463.15	SIRT6	protein_coding	cds-1
ENST00000601488.5	ENSG00000077463.15	SIRT6	protein_coding	cds-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31257032, 24284625, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.