RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_413106

mod Site

chr19:5077973-5077974:+

mod Type

m6A

Sequence

GGCTCTCCTGCACCGTGAAGACTGTGAACTCATTCAGTTCA

Motif Score

3.31938095238095

RNA Structure Motif

.....(((.((....)).)))..........

MFE

-3.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE85724, GSE90914, GSE93676, GSE93911

Support sub-Dataset List

GSM2739502, GSM2739535, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2417479, GSM2460360, GSM2464909, GSM2464911, GSM2464915

Cell/Tissue List

HeLa, Jurkat, HEK293A-TOA, TREX, endometrial

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000592175.5,ENST00000589104.5,ENST00000611640.4,ENST00000159111.9,ENST00000536461.5,ENST00000624683.1,ENST00000381759.8

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000592175.5	ENSG00000127663.15	KDM4B	processed_transcript	intron-4
ENST00000589104.5	ENSG00000127663.15	KDM4B	retained_intron	intron-2
ENST00000611640.4	ENSG00000127663.15	KDM4B	protein_coding	intron-8
ENST00000159111.9	ENSG00000127663.15	KDM4B	protein_coding	intron-8
ENST00000536461.5	ENSG00000127663.15	KDM4B	protein_coding	intron-7
ENST00000624683.1	ENSG00000127663.15	KDM4B	TEC	exon-1
ENST00000381759.8	ENSG00000127663.15	KDM4B	protein_coding	intron-8

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 27371828, 28525753, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.