RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_415777

mod Site

chr19:7903897-7903898:+

mod Type

m6A

Sequence

GTGCGGTGTTTGTCTGCCGGACTGACGGGCGGCCGGGCGGT

Motif Score

4.06504166666667

RNA Structure Motif

.....((.(((((.(.....).))))).)).

MFE

-8.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE112795, GSE87515

Support sub-Dataset List

GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM3083809, GSM3083810, GSM2332977, GSM2332978

Cell/Tissue List

HeLa, GSC-11

Seq Type List

m6A-seq

Transcript ID List

ENST00000468058.1,ENST00000397981.7,ENST00000397979.3,ENST00000397983.7

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000468058.1	ENSG00000076984.17	MAP2K7	retained_intron	exon-1
ENST00000397981.7	ENSG00000076984.17	MAP2K7	protein_coding	utr5-1
ENST00000397979.3	ENSG00000076984.17	MAP2K7	protein_coding	utr5-1
ENST00000397983.7	ENSG00000076984.17	MAP2K7	protein_coding	utr5-1

Conserved Sites

mm10:m6A_site_580322;susScr11:m6A_site_69377

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH40739	chr19:7903886-7903951	SBDH828-10743

PubMed ID

29507755, 31061416, 28344040

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.