Details of RNA Modification Site of hg38
mod ID m6A_site_415802 mod Site chr19:7911469-7911470:+
mod Type m6A Sequence AGGACAGTTTCCCTACAAGAACTGCAAGACGGACTTTGAGG
Motif Score 3.37338095238095
RNA Structure Motif (((((........))))).............
 MFE -1.40
Support Dataset Num 3 Support sub-Dataset Num 4
Support Dataset List GSE107954, GSE133132, GSE76414
Support sub-Dataset List

GSM2884195, GSM3900734, GSM2010454, GSM2010456
Cell/Tissue List CD34, BGC823, MM6
Seq Type List m6A-seq
Transcript ID List ENST00000468058.1,ENST00000397981.7,ENST00000397983.7,ENST00000397979.3
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000468058.1ENSG00000076984.17MAP2K7retained_intronexon-8
ENST00000397981.7ENSG00000076984.17MAP2K7protein_codingcds-9
ENST00000397983.7ENSG00000076984.17MAP2K7protein_codingcds-10
ENST00000397979.3ENSG00000076984.17MAP2K7protein_codingcds-9
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID 30065315, 31607270, 28017614

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1