| mod ID | m6A_site_418519 | mod Site | chr19:10224138-10224139:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTTCAGCATCCTCCTTCTGGACTATGCCTGTCCCGTCCACT |
||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||
| RNA Structure Motif |
((((..(((....)))..))))......... |
MFE | -7.30 | ||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 30 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM3396437, GSM3396438, GSM928399, GSM1135032, GSM1135033, GSM1166141, GSM1272358, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM2010454, GSM2010456, GSM2203047, GSM2203055, GSM2203059, GSM2417477, GSM2417478, GSM2417479, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460360, GSM2754216, GSM2754220, GSM2754226, GSM2754237, GSM2754244 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, U2OS, H1A, GM12878, LCLs, MM6, Huh7, HEK293A-TOA, iSLK, MSC, TREX |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||
| Transcript ID List | ENST00000588952.5,ENST00000592342.5,ENST00000646641.1 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_618439;rn6:m6A_site_95808;susScr11:m6A_site_68773 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1