| mod ID | m6A_site_418891 | mod Site | chr19:10350805-10350806:- | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGGCAGCCCTGCCTGGGAGGACTGGACCAGGCAGTGGCTGC |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...((((((((..........)))))))).. |
MFE | -15.40 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 22 | Support sub-Dataset Num | 62 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM3582047, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166143, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1723349, GSM1723351, GSM1908206, GSM1982257, GSM2010454, GSM2010456, GSM2203047, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2417477, GSM2417478, GSM2417479, GSM2460350, GSM2460354, GSM2460360, GSM2464905, GSM2464909, GSM2464911, GSM2464913, GSM2464917, GSM2464919, GSM2464921, GSM2464923, GSM2464927, GSM2564019, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, U2OS, H1A, H1B, A549, GM12878, LCLs, MT4, MM6, Huh7, Jurkat, peripheral-blood, HEK293A-TOA, iSLK, MSC, TREX, endometrial, HEC-1-A, NB4 |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000524462.5,ENST00000525621.5,ENST00000529422.1,ENST00000525976.5,ENST00000530220.1,ENST00000264818.10,ENST00000530560.5 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_33425 | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1