| mod ID | m6A_site_420561 | mod Site | chr19:11378533-11378534:- | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTGCACCCCCTTCACGGAGGACCCACCTGCTTCCCTGGAAG |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..........(((((.(......)))))).. |
MFE | -4.50 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 53 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM3083805, GSM3083809, GSM3083810, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM928399, GSM928403, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM2010454, GSM2010456, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460360, GSM2460362, GSM2754211, GSM2754224, GSM2754226, GSM2754235, GSM2464905, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464931, GSM2564019, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, HepG2, U2OS, MM6, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TIME, TREX, endometrial, HEC-1-A, NB4 |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000592375.6,ENST00000591958.5,ENST00000222139.11,ENST00000586890.5,ENST00000590927.1,ENST00000588859.5,ENST00000588681.5 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1