RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_425764

mod Site

chr19:15835143-15835144:+

mod Type

m6A

Sequence

TTGTTGTTAGAGGGCTTGGGACATTTCACTCTTTGCCAGCC

Motif Score

3.64304761904762

RNA Structure Motif

..(((((((..((((....))))))))))).

MFE

-4.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE125803, GSE83438, GSE93676, GSE93911

Support sub-Dataset List

GSM3582046, GSM3582047, GSM2203047, GSM2203051, GSM2203052, GSM2203055, GSM2203056, GSM2203060, GSM2203063, GSM2203064, GSM2460345, GSM2460347, GSM2460348, GSM2754211, GSM2754213, GSM2754235, GSM2754237, GSM2464911, GSM2464931

Cell/Tissue List

HeLa, Huh7, iSLK, endometrial, HEC-1-A

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000589333.3,ENST00000642440.1,ENST00000644103.1,ENST00000646397.1,ENST00000642256.1,ENST00000645251.1,ENST00000645221.1,ENST00000642894.1,ENST00000600160.3,ENST00000644400.1,ENST00000646128.1,ENST00000642269.1,ENST00000645821.1,ENST00000644567.1,ENST00000643567.1,ENST00000643552.1,ENST00000644174.1,ENST00000645805.1,ENST00000647185.1,ENST00000643818.1,ENST00000645708.1,ENST00000646494.1,ENST00000397381.5,ENST00000645177.1,ENST00000645877.1,ENST00000644796.1,ENST00000644730.1,ENST00000643846.1,ENST00000644845.1,ENST00000644962.1,ENST00000647292.1,ENST00000645156.1,ENST00000645764.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000589333.3	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000642440.1	ENSG00000214049.7	UCA1	lincRNA	intron-2
ENST00000644103.1	ENSG00000214049.7	UCA1	lincRNA	exon-4
ENST00000646397.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000642256.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645251.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645221.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000642894.1	ENSG00000214049.7	UCA1	lincRNA	exon-2
ENST00000600160.3	ENSG00000214049.7	UCA1	lincRNA	intron-1
ENST00000644400.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000646128.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000642269.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645821.1	ENSG00000214049.7	UCA1	lincRNA	intron-2
ENST00000644567.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000643567.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000643552.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000644174.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645805.1	ENSG00000214049.7	UCA1	lincRNA	intron-4
ENST00000647185.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000643818.1	ENSG00000214049.7	UCA1	lincRNA	intron-2
ENST00000645708.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000646494.1	ENSG00000214049.7	UCA1	lincRNA	intron-4
ENST00000397381.5	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645177.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645877.1	ENSG00000214049.7	UCA1	lincRNA	intron-4
ENST00000644796.1	ENSG00000214049.7	UCA1	lincRNA	intron-2
ENST00000644730.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000643846.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000644845.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000644962.1	ENSG00000214049.7	UCA1	lincRNA	intron-3
ENST00000647292.1	ENSG00000214049.7	UCA1	lincRNA	intron-1
ENST00000645156.1	ENSG00000214049.7	UCA1	lincRNA	exon-2
ENST00000645764.1	ENSG00000214049.7	UCA1	lincRNA	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

31597913, 27773535, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.