RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_425786

mod Site

chr19:15836082-15836083:+

mod Type

m6A

Sequence

TTCACTGACTCTCTTTTCGGACTCAGCCCACTTGCACCCAA

Motif Score

4.06504166666667

RNA Structure Motif

(((.(((......))).)))((......)).

MFE

-2.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE125803, GSE83438, GSE93676, GSE93911

Support sub-Dataset List

GSM3582046, GSM3582047, GSM2203047, GSM2203051, GSM2203052, GSM2203063, GSM2203064, GSM2460345, GSM2460347, GSM2460348, GSM2754211, GSM2754213, GSM2754235, GSM2754237, GSM2464931

Cell/Tissue List

HeLa, Huh7, iSLK, HEC-1-A

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000644400.1,rmsk_4951524,ENST00000644174.1,ENST00000397381.5,ENST00000642440.1,ENST00000645764.1,ENST00000647292.1,ENST00000645805.1,ENST00000644796.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000644400.1	ENSG00000214049.7	UCA1	lincRNA	exon-5
rmsk_4951524	rmsk_4951524	LTR7C	ERV1	exon
ENST00000644174.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000397381.5	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000642440.1	ENSG00000214049.7	UCA1	lincRNA	exon-4
ENST00000645764.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000647292.1	ENSG00000214049.7	UCA1	lincRNA	exon-3
ENST00000645805.1	ENSG00000214049.7	UCA1	lincRNA	exon-5
ENST00000644796.1	ENSG00000214049.7	UCA1	lincRNA	exon-4

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

31597913, 27773535, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.