| mod ID | m6A_site_447361 | mod Site | chr19:48626339-48626340:+ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTCACCTGTCTGCTCCGAGGACTGCCACTGCCCGGGGATGG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.........(((.((.(.......)))))). |
MFE | -5.70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 38 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM2739522, GSM2739523, GSM2739535, GSM2991403, GSM2987447, GSM2987448, GSM2987449, GSM1272364, GSM1272366, GSM1339429, GSM1982257, GSM2010456, GSM2324308, GSM2332975, GSM2332978, GSM2332986, GSM2332989, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460350, GSM2460352, GSM2460356, GSM2460358, GSM2460360, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2464923, GSM2464931, GSM2564019 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, H1B, H1A, A549, MM6, peripheral-blood, GSC-11, HEK293T, HEK293A-TOA, iSLK, MSC, TIME, TREX, endometrial, HEC-1-A, NB4 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000600537.5,ENST00000598088.5,ENST00000599029.2,ENST00000245222.8,ENST00000599748.5,ENST00000601704.1,ENST00000601712.5,ENST00000426514.2,ENST00000340932.7,ENST00000597434.5,ENST00000598574.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1