RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_447369

mod Site

chr19:48628458-48628459:+

mod Type

m6A

Sequence

CTGTATCCCGAGCGCCCAGAACTCTGCCTGGCATGGGAGGC

Motif Score

3.37338095238095

RNA Structure Motif

..(((.((...(((....)))....)).)))

MFE

-6.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE52600, GSE55572, GSE65380, GSE76367, GSE87190, GSE90914, GSE93676

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739535, GSM2991403, GSM1272366, GSM1272368, GSM1339395, GSM1339427, GSM1339439, GSM1594131, GSM1982257, GSM2324298, GSM2417477, GSM2417478, GSM2417479, GSM2460348, GSM2460352, GSM2460354, GSM2460358, GSM2754213

Cell/Tissue List

HeLa, H1A, H1B, hESCs, A549, GM12878, peripheral-blood, HEK293A-TOA, iSLK, MSC, TIME

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000245222.8,ENST00000598088.5,ENST00000599029.2,ENST00000597434.5,ENST00000340932.7,ENST00000601712.5,ENST00000426514.2,rmsk_5020032,ENST00000599748.5,ENST00000600537.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000245222.8	ENSG00000063176.15	SPHK2	protein_coding	intron-6
ENST00000598088.5	ENSG00000063176.15	SPHK2	protein_coding	intron-6
ENST00000599029.2	ENSG00000063176.15	SPHK2	protein_coding	intron-4
ENST00000597434.5	ENSG00000063176.15	SPHK2	non_stop_decay	intron-5
ENST00000340932.7	ENSG00000063176.15	SPHK2	protein_coding	intron-5
ENST00000601712.5	ENSG00000063176.15	SPHK2	protein_coding	utr3-6
ENST00000426514.2	ENSG00000063176.15	SPHK2	nonsense_mediated_decay	intron-4
rmsk_5020032	rmsk_5020032	L2a	L2	exon
ENST00000599748.5	ENSG00000063176.15	SPHK2	protein_coding	intron-5
ENST00000600537.5	ENSG00000063176.15	SPHK2	protein_coding	intron-6

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 25456834, 24981863, 25611135, 27117702, 29249359, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.