RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_448937

mod Site

chr19:49663395-49663396:-

mod Type

m6A

Sequence

AGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACG

Motif Score

3.62240476190476

RNA Structure Motif

(((.....)))..((.((.......)).)).

MFE

-5.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE110320, GSE74016, GSE87190, GSE93911

Support sub-Dataset List

GSM2987447, GSM1908206, GSM2324298, GSM2464931

Cell/Tissue List

HepG2, MT4, peripheral-blood, HEC-1-A

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000600911.5,ENST00000601291.5,ENST00000599144.5,ENST00000599223.5,ENST00000597636.5,ENST00000593818.5,ENST00000598108.5,ENST00000598808.5,ENST00000377139.8,ENST00000597369.1,ENST00000596788.1,ENST00000596756.5,ENST00000593922.5,ENST00000601809.5,ENST00000595240.5,ENST00000597198.5,ENST00000442265.2,ENST00000596822.5,ENST00000600453.1,ENST00000377135.8,ENST00000595034.5,ENST00000593337.5,ENST00000601373.5,ENST00000596765.5,ENST00000594387.1,ENST00000309877.11,ENST00000600022.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000600911.5	ENSG00000126456.16	IRF3	protein_coding	cds-2
ENST00000601291.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000599144.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000599223.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000597636.5	ENSG00000126456.16	IRF3	nonsense_mediated_decay	cds-2
ENST00000593818.5	ENSG00000126456.16	IRF3	protein_coding	utr5-3
ENST00000598108.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000598808.5	ENSG00000126456.16	IRF3	protein_coding	utr5-3
ENST00000377139.8	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000597369.1	ENSG00000126456.16	IRF3	retained_intron	exon-1
ENST00000596788.1	ENSG00000126456.16	IRF3	nonsense_mediated_decay	utr3-2
ENST00000596756.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000593922.5	ENSG00000126456.16	IRF3	protein_coding	utr5-3
ENST00000601809.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000595240.5	ENSG00000126456.16	IRF3	retained_intron	exon-2
ENST00000597198.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000442265.2	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000596822.5	ENSG00000126456.16	IRF3	protein_coding	utr5-2
ENST00000600453.1	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000377135.8	ENSG00000126456.16	IRF3	protein_coding	utr5-2
ENST00000595034.5	ENSG00000126456.16	IRF3	protein_coding	intron-2
ENST00000593337.5	ENSG00000126456.16	IRF3	protein_coding	cds-3
ENST00000601373.5	ENSG00000126456.16	IRF3	protein_coding	utr5-2
ENST00000596765.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000594387.1	ENSG00000126456.16	IRF3	retained_intron	exon-3
ENST00000309877.11	ENSG00000126456.16	IRF3	protein_coding	cds-2
ENST00000600022.5	ENSG00000126456.16	IRF3	protein_coding	utr5-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

3086759, 27572442, 29249359, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.