RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_448948

mod Site

chr19:49664948-49664949:-

mod Type

m6A

Sequence

CCCGAAAATATGGGTGAAGGACCTGTGCCGTGGCCCGTGAG

Motif Score

3.62240476190476

RNA Structure Motif

......((((.(.((.......)).).))))

MFE

-7.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE46705, GSE48037, GSE76414, GSE83438, GSE90914, GSE93676, GSE93911

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM3396438, GSM1135021, GSM1166141, GSM2010454, GSM2010456, GSM2203047, GSM2203060, GSM2417477, GSM2417479, GSM2460356, GSM2460360, GSM2464931

Cell/Tissue List

HeLa, HEK293T, U2OS, MM6, Huh7, HEK293A-TOA, TIME, TREX, HEC-1-A

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000601809.5,ENST00000377139.8,ENST00000601373.5,ENST00000593337.5,ENST00000599223.5,ENST00000597198.5,ENST00000596756.5,ENST00000309877.11,ENST00000596765.5,ENST00000597636.5,ENST00000600911.5,ENST00000600022.5,ENST00000596822.5,ENST00000599144.5,ENST00000593922.5,ENST00000601291.5,ENST00000598108.5,ENST00000600453.1,ENST00000597180.1,ENST00000593818.5,ENST00000594387.1,ENST00000598808.5,ENST00000595034.5,ENST00000377135.8

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000601809.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000377139.8	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000601373.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000593337.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000599223.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000597198.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000596756.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000309877.11	ENSG00000126456.16	IRF3	protein_coding	utr5-1
ENST00000596765.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000597636.5	ENSG00000126456.16	IRF3	nonsense_mediated_decay	utr5-1
ENST00000600911.5	ENSG00000126456.16	IRF3	protein_coding	utr5-1
ENST00000600022.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000596822.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000599144.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000593922.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000601291.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000598108.5	ENSG00000126456.16	IRF3	protein_coding	utr5-2
ENST00000600453.1	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000597180.1	ENSG00000126456.16	IRF3	processed_transcript	intron-1
ENST00000593818.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000594387.1	ENSG00000126456.16	IRF3	retained_intron	intron-1
ENST00000598808.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000595034.5	ENSG00000126456.16	IRF3	protein_coding	intron-1
ENST00000377135.8	ENSG00000126456.16	IRF3	protein_coding	intron-1

Conserved Sites

mm10:m6A_site_546405

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 24284625, 24209618, 28017614, 27773535, 28525753, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.