| mod ID | m6A_site_459646 | mod Site | chr2:8682214-8682215:+ | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TAGGAAAAACAGCCTGTCGGACCACAGCCTGGGCATCTCCC |
||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||
| RNA Structure Motif |
....(((.((((......)))).)))..... |
MFE | -6.40 | ||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 50 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2739534, GSM2987447, GSM2987449, GSM3582052, GSM3582053, GSM3582054, GSM1982257, GSM2010454, GSM2010456, GSM2203043, GSM2203047, GSM2203051, GSM2203055, GSM2203059, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283214, GSM2283215, GSM2324298, GSM2324306, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2460345, GSM2460354, GSM2460360, GSM2460362, GSM2754211, GSM2754213, GSM2754226, GSM2754235, GSM2464905, GSM2464915, GSM2464917, GSM2464921, GSM2464923, GSM2464927, GSM2464931, GSM2483505, GSM2564022 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, A549, MM6, Huh7, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293T, iSLK, MSC, TREX, endometrial, HEC-1-A, GSCs |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||
| Transcript ID List | ENST00000331129.3,ENST00000234091.8,ENST00000396290.2 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_130930;rn6:m6A_site_84836 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1