RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_461402

mod Site

chr2:12717872-12717873:+

mod Type

m6A

Sequence

CCGCCGTGAGCTCCCCGAAGACTGCACAAACTACCGCGGGC

Motif Score

3.31938095238095

RNA Structure Motif

(((((((......)).)).))).........

MFE

-3.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE120229, GSE48037, GSE52600, GSE65380, GSE85724, GSE87515, GSE90914, GSE93676, GSE93911

Support sub-Dataset List

GSM3396437, GSM1166139, GSM1166140, GSM1166143, GSM1272360, GSM1272364, GSM1272368, GSM1594131, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283215, GSM2332975, GSM2417477, GSM2417478, GSM2417479, GSM2460354, GSM2754220, GSM2464911, GSM2464931

Cell/Tissue List

HEK293T, U2OS, H1B, GM12878, Jurkat, CD4T, GSC-11, HEK293A-TOA, MSC, endometrial, HEC-1-A

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000155926.8,ENST00000381465.2

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000155926.8	ENSG00000071575.11	TRIB2	protein_coding	utr5-1
ENST00000381465.2	ENSG00000071575.11	TRIB2	protein_coding	intron-1

Conserved Sites

mm10:m6A_site_129650;panTro5:m6A_site_40093;rheMac8:m6A_site_14843

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH45160	chr2:12717819-12717879	SBDH828-12065

PubMed ID

24209618, 25456834, 25611135, 27371828, 28344040, 28525753, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.