| mod ID | m6A_site_461682 | mod Site | chr2:15945918-15945919:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGCTTTCTCACGCTCAGGGACCACGTGCCGGAGTTGGTAA |
|||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||
| RNA Structure Motif |
.......((((.((.((...)).)).)))). |
MFE | -8.10 | |||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 26 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM2884195, GSM1166139, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339407, GSM1908206, GSM2203047, GSM2203056, GSM2203060, GSM2203064, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2417477, GSM2417479, GSM2464905, GSM2464913, GSM2464915 |
|||||||||||||||
| Cell/Tissue List |
HeLa, CD34, U2OS, H1A, H1B, hNPCs, hESCs, fibroblasts, MT4, Huh7, Jurkat, HEK293A-TOA, endometrial |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000281043.4,ENST00000638417.1 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_129377;susScr11:m6A_site_86786 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1