| mod ID | m6A_site_471882 | mod Site | chr2:47799732-47799733:+ | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCCATTGTTCGAGATTTAGGACTCTAGTGGCACACTATCCC |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.((((........))))...((((...)))) |
MFE | -3.70 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 28 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM3396437, GSM3396438, GSM3582054, GSM928399, GSM928401, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166142, GSM1166143, GSM1339401, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1828596, GSM2203060, GSM2460345, GSM2460347, GSM2460352, GSM2460360, GSM2754237 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, HepG2, U2OS, fibroblasts, Huh7, iSLK, MSC, TREX |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000614496.4,ENST00000538136.1,ENST00000616033.4,ENST00000622629.4,ENST00000540021.5,ENST00000234420.9,ENST00000445503.5,ENST00000652107.1 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1